CRISPR In-Class Exercise
Streptococcus thermophilus repeat sequence (CRISPR 1):
GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC
(Remember that when you search for the sequence that may need to try the reverse complement.)
Assignments:
- Group 1 - S. thermophilus strain CS18
- Group 2 - S. gordonii strain CW
- Group 3 - S. mitis strain S2022
- Group 4 - S. salivarius strain ATCC 25975
- Group 5 - S. oralis strain SF100
Folder with sequences
Links you will or may need:
NCBI BLASTN for searching nucleotide sequences
Reverse Complement Tool
If needed, to help analyze genomic sequences: Remove Line Breaks utility
© 2025 Curtis Loer, Dept of Biology, USD. All rights reserved. Simple, hand-coded pages.