Misale et al., 2012

Full Methods

Note: None of the links will work in this copy of the original online Nature version (full methods).

Cell culture and generation of resistant cells

DiFi cells were cultured in F12 medium (Invitrogen) supplemented with 5% FBS, and Lim1215 cells were cultured in RPMI-1640 medium (Invitrogen) supplemented with 5% FBS and 1 μg ml−1 insulin. DiFi parental cells were plated in 100 mm Petri dishes with 2.5% FBS, and exposed to a constant dose of cetuximab (350 nM) for one year to obtain the resistant counterpart DiFi-R1. The DiFi-R2 derivative was obtained by increasing the cetuximab dosage stepwise from 3.5 nM to 350 nM during the course of a year. The same protocols were applied to Lim1215 cells, with variations with respect to cetuximab concentrations: for Lim-R1, cetuximab was used at 1,400 nM, and for Lim-R2, the drug concentration increased stepwise from 350 nM to 1,400 nM. For Lim1215, both protocols required at least 3 months of drug treatment. The Lim1215 parental cell line had been described previously20 and was obtained from R. Whitehead, with permission from the Ludwig Institute for Cancer Research. The genetic identity of the cell lines used in this study was confirmed by short tandem repeat (STR) profiling (Cell ID, Promega)

Drug viability assays

Cetuximab was obtained from Pharmacy at Niguarda Ca’ Granda Hospital. The MEK inhibitor AZD6244 and the PI(3)K inhibitor GSK1059615 were purchased from Sequoia Chemicals and Selleck Chemicals, respectively. Cell lines were seeded in 100 μl medium at appropriate densities (5 × 104 and 1.5 × 104 cells per well for DiFi and Lim1215 cells, respectively) in 96-well plastic culture plates. After serial dilutions, drugs in serum-free medium were added to cells, and medium-only containing wells were added as controls. Plates were incubated at 37 °C in 5% CO2 for 72–168 h, after which cell viability was assessed by ATP content using the CellTiter-Glo luminescent assay (Promega).

Mutational analysis

RAS genotyping was performed using the iPLEX assay (Sequenom), which is based on a single-base primer extension assay. In brief, multiplexed PCR and extension primers are designed for a panel of known mutations. After PCR and extension reactions, the resulting extension products are analysed using a matrix-assisted laser desorption/ionization–time-of-flight (MALDI–TOF) mass spectrometer. For 454 picotiter plate pyrosequencing (Roche), PCR products were generated using primers designed to span exons 2, 3 and 4 in KRAS and adapted with 5′ overhangs to facilitate emulsion PCR (emPCR) and sequencing. After amplification by emPCR, beads containing DNA were isolated. A total of 34,000 beads were sequenced in both directions, yielding 1,000–5,000 sequencing reads on average per sample (~1,000 reads per amplicon per sample) using GSFLX. To detect variants in 454 pyrosequencing data, reads were mapped with the Burrows-Wheeler aligner (BWA) using the bwasw mode for aligning long reads. The generated SAM file was then run through the Picard MarkDuplicate program to remove duplicated reads (reads with the same initial starting point). The file was then processed with the GATK BaseQ recalibrator. Finally, we generated pileups using Samtools and called variants using VarScan. For Sanger sequencing, all samples were subjected to automated sequencing by ABI PRISM 3730 (Applied Biosystems). All mutations were confirmed twice, starting from independent PCR reactions.

All primer sequences are available on request. Exome sequencing was carried out by exome capture using the SeqCap EZ human exome library v1.0 (Nimblegen) and subsequent pyrosequencing of the captured fragments by means of 454Flx sequencer (Roche), according to the manufacturer’s protocols. A total of 1.2 million reads were sequenced for an average exome depth of ×4. The reads were mapped using the manufacturer’s mapping tools and the depth of the reads was used as an estimator of the copy number value in the two parental and resistant DiFi samples. Average read depths were calculated within overlapping 100,000-base-pair wide windows for Fig. 1b, whereas average read depths were calculated for exons and genes and plotted as dots and segments, respectively, in Supplementary Fig. 3a, b.

Tissue procurement

Tumour specimens were obtained through protocols approved by the Institutional Review Board of Memorial Sloan-Kettering Cancer Center (protocol 10-029) and Ospedale Niguarda Ca’ Granda (protocols 1014/09 and 194/2010). All tumour specimens were formalin-fixed paraffin-embedded. All patients provided informed consent and samples were procured and the study was conducted under the approval of the Review Boards and Ethical Committees of the Institutions. Details about the clinical characteristic of the patients are provided in Supplementary Table 2.

BEAMing procedure

DNA was extracted from plasma using the QIAamp circulating nucleic acid kit (QIAGEN) according to manufacturer’s instructions. BEAMing was performed as described previously11. The first amplification was performed in a 50 μl PCR reaction, containing DNA isolated from 1 ml of plasma, 1× Phusion high-fidelity buffer, 1.5 U Hotstart Phusion polymerase (NEB, BioLabs), 0.5 μM of each primer with tag sequence, 0.2 mM of each deoxynucleoside triphosphate, and 0.5 mM MgCl2. Amplification was carried out using the following cycling conditions: 98 °C for 45 s; 2 cycles of 98 °C for 10 s, 67 °C for 10 s, 72 °C for 10 s; 2 cycles of 98 °C for 10 s, 64 °C for 10 s, 72 °C for 10 s; 2 cycles of 98 °C for 10 s, 61 °C for 10 s, 72 °C for 10 s; 31 cycles of 98 °C for 10 s, 58 °C for 10 s, 72 °C for 10 s. PCR products were diluted, and quantified using the PicoGreen double-stranded DNA assay (Invitrogen). A clonal bead population is generated performing emPCR. PCR mixture (150 μl) was prepared containing 18 pg template DNA, 40 U platinum Taq DNA polymerase (Invitrogen), 1× platinum buffer, 0.2 mM dNTPs, 5 mM MgCl2, 0.05 μM Tag1 (TCCCGCGAAATTAATACGAC), 8 μM Tag2 (GCTGGAGCTCTGCAGCTA) and 6 × 107 magnetic streptavidin beads (MyOne, Invitrogen) coated with Tag1 oligonucleotide (dual biotin-TSpacer18-TCCCGCGAAATTAATACGAC). The 150-μl PCR reactions were distributed into the wells of a 96-well PCR plate together with 70 μl of the emusifire oil. The water-in-oil emulsion was obtained by pipetting. The PCR cycling conditions were: 94 °C for 2 min; 50 cycles of 94 °C for 10 s, 58 °C for 15 s, 70 °C for 15 s. All primer sequences are available on request.

Immunoblot analysis

Before biochemical analysis, all cells were grown in their specific media supplemented with 5% FBS. Total cellular proteins were extracted by solubilizing the cells in boiling SDS buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl and 1% SDS). Western blot detection was done by enhanced chemiluminescence (GE Healthcare). The following antibodies were used for western blotting (all from Cell Signaling Technology, except where indicated): anti-phospho-AKT S473; anti-phospho-AKT T308; anti-AKT; anti-phospho-p44/42 ERK (Thr 202/Tyr 204); anti-p44/42 ERK; anti-P-MEK1/2 (Ser 217/221), anti-MEK1/2; anti-KRAS (Santa Cruz); anti-EGFR (clone13G8, Enzo Life Sciences); anti-phospho EGFR (Tyr 1068); anti-actin and anti-vinculin (Sigma-Aldrich).

KRAS activation assay (RAS-GTP)

The analysis of KRAS activation was performed by an immunoprecipitation assay with a GST fusion protein containing the Ras-binding domain (RBD) of RAF1 (GST–RAF1-RBD), as previously described12. The KRAS protein was detected with an anti-KRAS (F234) monoclonal antibody (Santa Cruz).

Gene copy number analysis

Parental and resistant cell lines were trypsinized, washed with PBS and centrifuged; pellets were lysed and DNA was extracted using the wizard SV genomic kit (Promega) according to the manufacturer’s directions. Real-time PCR was performed with 150 ng of DNA per single reaction using GoTaq QPCR Master Mix (Promega) and determined by real-time PCR using an ABI PRISM 7900HT apparatus (Applied Biosytems).

All primer sequences are available on request. Exome sequencing was carried out by exome capture using the SeqCap EZ Human Exome Library v1.0 (Nimblegen) and subsequent pyrosequencing of the captured fragments by means of 454Flx sequencer (Roche), according to manufacturer’s protocols. A total of 1.2 million reads were sequenced for an average exome depth of ×4. The reads were mapped using the manufacturer’s mapping tools and the depth of the reads was determined and used as an estimator of the copy number value in the two parental and resistant DiFi samples. Average read depths within overlapping 100,000-base-pair wide windows were calculated and plotted in Fig. 1c; average read depths within exons and genes were calculated and plotted as dots and segments, respectively, in Supplementary Fig. 4a, b.

Immunohistochemistry assay

KRAS protein expression was evaluated by immunohistochemistry performed on 3-μm-thick tissue sections using a specific KRAS (F234) antibody (SC-30, mouse monoclonal IgG2a Santa Cruz Biotechnology; dilution 1:100) and the automated system BenchMark Ultra (Ventana Medical System, Roche) according to the manufacturers’ instructions, with minimum modifications. KRAS protein expression was detected at the cytoplasmatic and membrane level. Samples were considered positive when the expression of protein was present in at least 10% of cells. Healthy tissue, that is, normal colon mucosa, was used as an internal negative control; a slide with the DiFi-R2 cell line was used as an external positive control. Images were captured with the AxiovisionLe software (Zeiss) using an Axio Zeiss Imager 2 microscope (Zeiss).

FISH analysis

All analyses were performed on 3-μm-thick sections of formalin-fixed paraffin-embedded tumour tissue, provided by the Department of Anatomy Pathology of Niguarda Hospital, and on metaphase chromosomes and interphase nuclei, obtained from the DiFi cell line culture following the standard procedures. Tissue sections for FISH experiment were prepared according to the manufacturer’s instructions of the histology FISH accessory kit (Dako). For both types of sample the last steps before hybridization were: dehydration in ethanol series (70%, 90% and 100%), three washes (5 min each) and air drying.

Dual colour FISH analysis was performed using a 10-µl mix-probe made up by 1 µl CEP12 α-satellite probe (12p11-q11) labelled in SpectrumOrange (Vysis), 1 μl BAC genomic probe RP11-707G18 (12p12.1) spanning an approximately 176-kilobase region encompassing the KRAS gene, labelled in SpectrumGreen (Bluegnome21) and 8 μl LSI-WCP hybridization buffer (Vysis) for each slide. Probes and target DNA of specimens were co-denatured in HYBRite System (Dako) for 5 min at 75 °C and then hybridized overnight at 37 °C. Slides were washed with post-hybridization buffer (Dako) at 73 °C for 2 min and counterstained with 4′,6-diamidino-2-phenylindole (DAPI II; Vysis). FISH signals were evaluated with a Zeiss Axioscope Imager.Z1 (Zeiss) equipped with single and triple band pass filters. Images for documentation were captured with CCD camera and processed using the MetaSystems Isis software. Samples with a ratio greater than 3 between KRAS gene and chromosome 12 centromere signals, in at least 10% of 100 cells analysed in 10 different fields, were scored as positive for KRAS gene amplification. Healthy tissue, that is, normal colon mucosa, was used as an internal negative control.

Plasmids and viral vectors

All experimental procedures for targeting vector construction, AAV production, cell infection and screening for recombinants have been described elsewhere12.

Statistical analysis

Data are presented as the mean ± s.d. and n = 3. Statistical significance was determined by a paired Student’s t-test or two-tailed unpaired Mann–Whitney test (Fig. 3c). P < 0.05 was considered statistically significant.